Week 8

1.       Homeostasis is the process through which an organism maintains certain internal conditions such as the humans body temperature. For example, heat. Humans internal body temperature must be at a specific temperature to prevent heating or overheating. This process is important as it keeps our organs and even cells working properly. If the human body becomes too hot, it is possible for people to overheat and have complications.

2.       Four ways that human have adapted to stress are cultural practices and technology as well as acclimatization and developmental acclimatization which is responding while growing. Finally, evolution. Developmental traits are changes in DNA of a population. These are traits that you are born with.  They can change during development depending upon environmental factors like nutrition.

3.       Human Variation is extremely important because is our genetics. Human genetics helps us understand the human body as well as discover and know the genetic contribution to many diseases.

4.       Race can influence a population by influencing nutrition, tool use, reproductive behaviors, clothing, and social practices. Environmental influences gives us a better understanding of adaptation better than race because environmental influences the way a population develops because it has to adapt to external factors.

Week 7 Language Blog

Overall the experiment was quite interesting and comical. My partner decided to talk about the basketball tournament (March Madness) and I was not agreeing to his conversation therefore it was hard to express myself without using my voice because I couldn’t argue back.  I also didn’t realize how much hand gestures I use when I speak than when I was missing one or the other it was frustrating to me to be restricted to just using hand gestures. My partner was taking advantage of the situation and telling me everything he agreed on and that I disagreed on because all I could really do was wave my finger or put a hand up so that I could communicate. Another thing was that it was like a guessing game since he had to figure out what I was trying to say with my gestures so he would repeat a lot of the phrases and I will either shake my head yes or no.

Overall I think I was in control because the main topic of our conversation was me signaling him. Whatever signal or symbol I gave my partner that was the direction that the conversation would go into. It was hard to argue with my partner or continue the conversation so we didn’t really get into too much detail either but we managed to get the main points across.

In my opinion I feel that if me and my partner where two different cultures the one that would have the advantage would be my partner since he used language instead of symbols. Using symbols gets the “big picture” across but misses out on the details that can be communicated if you use language.  Probably the culture that spoke a language would think that they are smarter or more advanced culture than the one that uses symbolism to communicate. 

Part 2

This part of the experiment was also difficult because I am the type of individual that uses face expression and hand gestures when I communicate and in some instances, I also use body language. My partner agreed on how he had to do a double take because since I was using no expression but my voice he didn’t understand my emotion toward our conversation and he said that made it difficult because he didn’t know where the conversation was going. So, the conversation was basic and we didn’t get into too much detail because I was lacking emotion.

What this experiment taught me was that “signs” are useful when we are communicating. Certain body language can make or break a conversation. The information we get from language with symbolism or a tone of voice and expression can say a lot or little about a conversation.

Reading body language is important because bod language reinforces what a person is communicating. You can also observe body language to detect information about emotions or attitudes. Body language can be used as a clue to discrepancies in behavior to really see what a person is thinking or feeling. Body Language can help us survive because body language can express emotion so if we use body language in a positive way it can open doors.

Not all body language is created equal. You can be a class and someone could be slouching; you may think they’re tired but there just comfortable. Someone can be sitting up straight and you might get the impression that the individual is proper but really, they have a back problem. That is why I believe that language and symbolism go hand in hand. They average each other to get the point across, a lot of problems can be solved with just communicating.  

Piltdown hoax

Week 5 blog March 7, 2017

1.The Piltdown hoax was “discovery” made by Charles Dawson in the early 1900 s in England in a city of Piltdown. Charles Dawson made the discovery of a human skull (jaw bone). He invited Arthur Smith Woodward which was one of England’s leading geologist along with Father Pierre wo was a paleontologist to work with him to keep digging for more artifacts. Other credible men were brought on board to give credibility to the finds like Arthur Keith that believed that big brains were developed before walking upright (which was the opposite). Also, Arthur Woodward which specialized in fish fossils. By the 1920’s new methods of testing were introduced which included fluorine testing. Fluorine testing was done on the Piltdown fossils and the staining dated back sooner than what was originally said. Other artifacts were being discovered around the world and the artifacts did not match the Piltdown man artifacts and the artifacts found were less human.  Then after World War 2 a better method of testing methods was introduced and more accurate that proved that the Piltdown fossils had stains falsified in them and the teeth in the jawbone were filed down. The method proof that the jaw bone came from a female orangutan that dated back to 100 years and not thousands of years and this created an uproar amongst the science since all signs were leading that the Piltdown man was a hoax.

2.One of the faults that come in place is that one there wasn’t the necessary elements that could help these scientists come up with an accurate find. One thing that stand out is that the video mentions how maybe Charles Dawson committed the hoax because he was jealous that the rest of the world was making discoveries and England was not.

3.Positive aspects of the scientific method that proved that the Piltdown man was a hoax was the investigation process. If the jaw bone was observed as well as other data being collected to compare this artifact to others discovered around the world. At the time, no one really questioned the findings, and I feel in part was because the people that were behind was respected science people in England that no one felt the need to questioned the finding. Thankfully science keeps evolving and creating new testable methods that catch hoaxes. Like the fluorine testing that proved that the stains were falsified in the fossils.

4. The human factor is accounted to our instinct; and I believe that is very important in humans but that’s why we need science to back up what we humans discovered. Humans and science make a team without wither or it wouldn’t work.

5.The life lesson that I take with this hoax is that we must questioned everything. Like the saying, says “not everything that shines is gold” so as humans we must questioned the why, where, and when and even the how things happen.

Week 3 Analogy/Homology

1.

    A. Two different species that possess a homologous trait is humans and horses. Both are mammals. Humans are bipeds (walk with two feet) and horses are quadrupeds (walk on all four legs).

    B. The homologous trait of humans and horses are the forearms. Forearm for horses and forearm for humans. In the horse the forelimb is very delicate since its responsible for 60% of the horse’s weight. Its located in the two from legs of the horse. As for humans, the forearm is between the elbow and our wrists. Humans use the forearm to grasp things and horses use their forearms for walking and running.

   C.  Aside from both species being mammals, I couldn’t find the ancestor of humans and horses; it’s safe to say that both are primates. Both share flexible and similar body parts of a primate.

  D.

2A. Horses and humans also possess analogous traits. An analogous trait in both humans and horses are the limbs in both species.

B. The structure of the limbs was independently evolved. Both limbs in horses and humans have different structures and evolutionary histories. Although, limbs are used for the same function (locomotion) in both humans and horses.

C. Common ancestry between humans and horses come from primates. The traits are analogous because they look different and are placed different in the humans and horses anatomy.

D.

week 2 Decode me!!

 
AUGUGGACCCAAGCCACUUGCAGAUUCAACUAG

Historical influences week 1

Week 1 Historical Influences

1.One individual who I feel had a great influence over Darwin’s development in natural selection was a man named Charles Lyell. A lawyer turned geologist after seeing that people didn’t have an answer for a catastrophe. People fell back on the bible. Lyell wanted and believe that there was a science behind it, therefore I feel geology is very important since if it was ant for geology how would we predict what we know now. We don’t blame the bible anymore.

2.Charles Lyell made a major contribution to the science community by believing and discovering the science of geology after learning that one catastrophe was blamed on the bible “Noah’s Flood”. If it was ant for geology how would we know how tell a storm is coming or to prepare for it? That why I believe it’s a big contribution because Charles Lyell discovered it in 1800.s and is still a valuable tool today.

Source = http://evolution.berkeley.edu/evolibrary/article/history_12

“Uniformitarianism Charles Lyell”

3.The point most affected by the individuals work of Charles Lyell is bullet point “If the environment changes, the traits that are helpful or adaptive to that environment will be different”. Charles Lyell theory had everything to do with the environment. When the environment changes so do Earth and as these catastrophes happen; it forms Earth as well.

4. Well Charles Darwin obviously shares the same concept than these individuals. There individuals that believe everything has a reason and things don’t just happen, there’s always an explanation behind it, the science of things and I believe Charles Darwin would of came up with the idea of natural selection anyway.   

5.The attitude of the church affected Charles Darwin significantly because it caused controversy. Darwin felt the backlash of the church therefore he would hold his publishing in my opinion out of respect.